A novel selective 11b-hydroxysteroid dehydrogenase type 1 inhibitor prevents human adipogenesis

300 I J BUJALSKA and others . 11b-HSD1 is essential for human adipogenesis

of ribosomal 18S rRNA (provided as a pre-optimized mix;
Perkin-Elmer) as an internal reference. All target gene probes
were labelled with the fluorescent label FAM and the 18S probe
with the fluorescent label VIC. Reactions were as follows: 50 8C
for2 min, 95 8C for 10 min, and then 40 cycles of95 8Cfor15s
and 60 8C for 1 min. Data were analysed according to the
manufacturer’s guidelines and were obtained as C_t values (the
cycle number at which logarithmic PCR plots cross a calculated
threshold line) and used to determine dC_t values (dC_tZC_t of the
target gene minus C_t of the internal reference, 18S). Primers and
probes for 11b-HSD1, H6PDH and G3PD were designed using
PrimerExpress 1.0 software (Applied Biosystems). Sequences
from 50 to 30 are shown in Table 2. Expression assay kits were
purchased from Applied Biosystems to measure the gene
expression of GRa, GLUT-4, PPARg2 and FABP4.

Statistical analysis

Where data were normally distributed, unpaired Student’s t-test
was used to compare single treatments with control. If normality
tests failed, then non-parametric tests were used. One-way
ANOVA on ranks was used to compare multiple treatments
(SigmaStat 3.1, Systat Software Inc., Point Richmond, CA,
USA). Results were expressed as mean valuesGS.D. or s.e.m.
values and a P value of !0.05 was accepted as statistically
significant. Statistical analysis on real-time PCR data was
performed on mean DCt values and not on fold changes.

Results

Kinetics of PF-877423 upon recombinant 11b-HSD1 protein

The potency for PF-877423 was strongly affected by the
presence of the substrate in the assay buffer (Fig. 1): K_i^app
values increased at high cortisone concentration, suggesting
that the inhibitor behaved as a reversible and competitive
inhibitor against cortisone. Fitting the experimental data
using equation (2) provided a value of 0.2G0.04 and 333.4G
109.2 nM for the inhibition constant, K_i, and the apparent
Michaelis-Menten constant, K_m respectively.

Specificity of PF-877423

11b-HSD enzyme assays on HEK293T1 and HEK293T2 cells
showed total abolition of dehydrogenase (12.4G1.0 vs 0.2G
0.01, % cortisol to cortisone conversion, meanGS.D.) and oxo-
reductase (34.7G0.6 vs 0.4G0.1, % cortisone to cortisol
conversion, meanGS.D.) activities of 11b-HSD1 following
incubation with 100 nM PF-877423 for 24 h (Fig. 2A), but
PF-877423 had no effect on 11b-HSD2 activity (63.6G4.0 vs
62.2G4.4, % cortisol to cortisone conversion, meanGS.D.,
control versus PF-877423 respectively; Fig. 2B). No toxic
effects of PF-877423 were observed up to 10 mM concentrations
using a commercially available assay kit (CellTiter 96 Aqueous,
Promega; data not shown).

Table 2 Primer and probe sequences for various human genes for the real-time PCR

ATGGTGAATATCATCATGAA AAAGATTC

GACCCACGTTTCTCACTGAC TCT

TCAGGTTGAGGCCACCATC

TCGTCTACCCCCTTAATAAG AGATATG

CATGCTCATTCTCAACCACATCA CCAACA

CCGTGGCGCTACTCATGGACAC A

AGGGGCCACCACAGACTTGCAC AT

AGGGCCATCTGAAGGCAAACGC C

Primers and probes were designed using PrimerExpress software (Applied Biosystems, UK).

Journal of Endocrinology (2008) 197, 297-307

<<   1   2   3   4   5   6   7   >>

More intriguing information